Phosphohistidine phosphatase

Author: cbrc

August undefined, 2024

WebPTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This protein contains a C-terminal PTP domain and an N-terminal domain homologous to the band 4.1 superfamily of cytoskeletal-associated proteins. WebApr 1, 2016 · Phosphohistidine phosphatase 1 (PHPT1), the only known phosphohistidine phosphatase in mammals, regulates phosphohistidine levels of several proteins including those involved in signaling, lipid metabolism, and potassium ion transport. While the high-resolution structure of human PHPT1 (hPHPT1) is available and residues important for …

126053682 - Gene ResultLOC126053682 14 kDa phosphohistidine phosphatase …

WebApr 1, 2016 · Phosphohistidine phosphatase 1 (PHPT1), the only known phosphohistidine phosphatase in mammals, regulates phosphohistidine levels of several proteins including those involved in signaling,... WebLHPP抗体,Phospholysine phosphohistidine inorganic pyrophosphate phosphatase, hLHPP, 3.1.3.-, 3.6.1.1, LHPP. This LHPP antibody is generated from a rabbit immunized with a KLH conjugated synthetic peptide between 84-116 amino acids from the Central region of human LHPP. Disclaimer note: The observed molecular weight of the protein may vary ... flower opal earrings

First Structure of a Eukaryotic Phosphohistidine …

WebMar 10, 2024 · The 14-kDa phosphohistidine phosphatase (PHP14) protein, also called PHPT1, was the first histidine phosphatase identified in vertebrates (5, 6). In our previous … WebPhosphohistidine phosphate inorganic pyrophosphatase (LHPP)is a member of the haloacid dehalogenase like hydrolase domain-containing (HDHD) gene family. It is also a new kind of inorganic pyrophosphatase (PPase), which is considered to be essential for life and closely related to cell survival, growth, and differentiation. WebNov 10, 2006 · The structure of phosphohistidine phosphatase (PHPT1), the first identified eukaryotic-protein histidine phosphatase, has been determined to a resolution of 1.9Å … flower opening time lapse

14-kDa phosphohistidine phosphatase is a potential therapeutic …

The phosphohistidine phosphatase SixA dephosphorylates the ...

WebResearch in the field of protein-bound phosphohistidine phosphorylation has been hampered by the difficulties in analysis and detection of phosphohistidine. Therefore a screening method was developed primarily for the analysis of phosphohistidine phosphatase 1 (PHPT1) activity. Methods. A highly positively charged substrate, Ac-Val … WebJul 12, 2009 · A mammalian 14-kDa phosphohistidine phosphatase, also denominated PHPT1, was found 6 years ago that provided a new tool in the study of phosphohistidine phosphorylation. The localization of PHPT1 mRNA by Northern blot analysis revealed high expression in heart and skeletal muscle. The main object of the present study was to … green and black checkered haoriWebResearch in the field of protein-bound phosphohistidine phosphorylation has been hampered by the difficulties in analysis and detection of phosphohistidine. Therefore a … green and black checkered background

"" - Phosphohistidine phosphatase

Phosphohistidine phosphatase

WebGene ID: 126053682, updated on 16-Feb-2024. Summary Other designations. 14 kDa phosphohistidine phosphatase-like WebNov 23, 2024 · Here we identify the mechanism by which a bacterial phosphohistidine phosphatase dephosphorylates the nitrogen-related phosphotransferase system, a …

Did you know?

WebMar 10, 2024 · Liver fibrosis, a major cause of morbidity and mortality worldwide, leads to liver damage, seriously threatening human health. In our previous study, we demonstrated that 14 kDa phosphohistidine phosphatase (PHP14) was upregulated in fibrotic liver tissue and involved in the migration and lamellipodia formation of hepatic stellate cells (HSCs). … WebNov 28, 2024 · Phosphohistidine phosphatase 1 (PHPT1), one of the few known protein pHis phosphatases, regulates important cellular processes, and its genetic knockdown …

WebTarget Information: Phosphatase that hydrolyzes imidodiphosphate, 3- phosphohistidine and 6-phospholysine. Has broad substrate specificity and can also hydrolyze inorganic diphosphate, but with lower efficiency (By similarity) Supplier Page. Supplier Page from antibodies-online for anti-LHPP Antibody. WebThe enzyme glucose 6-phosphatase (EC 3.1.3.9, G6Pase; systematic name D-glucose-6-phosphate phosphohydrolase) catalyzes the hydrolysis of glucose 6-phosphate, resulting in the creation of a phosphate group and free glucose: D -glucose 6-phosphate + H 2 O = D -glucose + phosphate

WebJan 1, 2024 · SixA was first reported to be a phosphohistidine phosphatase that dephosphorylates the histidine-containing phosphotransfer domain of the E. coli sensor kinase ArcB (32, 41), and the activity was shown to be dependent on the conserved active-site histidine (His8) of SixA. However, beyond the two reports that proposed this activity 2 … WebPhospholysine phosphohistidine inorganic pyrophosphate phosphatase - Wikipedia Phospholysine phosphohistidine inorganic pyrophosphate phosphatase Phospholysine …

WebJun 16, 2024 · Phosphohistidine (pHis) was discovered 60 years ago as a mitochondrial enzyme intermediate; since then, evidence for the existence of and phosphohistidine has emerged, together with examples where protein function is regulated by reversible histidine phosphorylation. pHis is chemically unstable and has thus been challenging to study.

WebAug 21, 2015 · Structures of the three forms of phosphohistidine: (A) 1-phosphohistidine; (B) 3-phosphohistidine; (C) 1,3-diphosphohistidine. In prokaryotes it is now recognized that that both serine/threonine and tyrosine kinases, as well as their cognate phosphatases also occur (for reviews, see Bakal and Davies, 2000; Pereira et al., 2011; Chao et al., 2014 ). flower opening and closure: an updateWebDec 4, 2024 · Phosphohistidine phosphatase 1 (PHPT1) also dephosphorylates phospholysine of chemically phosphorylated histone H1 and polylysine. Ups J Med Sci 2015; 120 :20–27. Article Google Scholar green and black cat squishmallowWebPhosphohistidine phosphatase 1 (PHPT1), also named protein histidine phosphatase (PHP), is a eukaryotic enzyme dephosphorylating proteins and peptides that are phosphorylated … green and black check flannel shirtWebPhospholysine phosphohistidine inorganic pyrophosphate phosphatase: Lhpp: CCCTGGGAAAAGGACGCTATT AATCATGATGGCCTGGTGGG: Mechanistic target of rapamycin kinase: Mtor: CACCCATCCAACCTGATGCT ATCGAGACCGGTAACCTCCA: Regulatory associated protein of MTOR, complex 1: Rptor: TGGGTCTTCAACAAGGTAGC … green and black checkered jacketWebDec 4, 2024 · This gene encodes an enzyme that catalyzes the reversible dephosphorylation of histidine residues in proteins. It may be involved in the dephosphorylation of G-beta … green and black checkered wool jacketWebJan 1, 2008 · Phosphohistidine phosphatase 1 (PHPT1) is the first protein histidine phosphatase identified in vertebrates. The NMR assignments of human PHPT1 are essential for solution structure... green and black checkered rugWebNov 10, 2006 · Phosphatases are a diverse group of enzymes that regulate numerous cellular processes. Much of what is known relates to the tyrosine, threonine, and serine phosphatases, whereas the histidine phosphatases have not been studied as much. green and black checkered pattern